Advanced Search

Search ADAMTS13 variants using HGVS, protein change, rsID, variant class, exon/intron location, domain assignment and gnomAD allele frequency.

Clear form Browse full list

Search results

385 matching variants found.
mut_id mut_syn_HGVS aa_syn rsid mut_type mut_eff clinvar_classification exon_location e_i_numb d_id coordinate_GRCh38 gnomAD_AF
1 c.22dupG p.Ala8GlyfsTer131 . Duplication frameshift_variant Pathogenic/Likely pathogenic exon 1 133422462 0.00000433
2 c.83G>A p.Trp28Ter rs964642490 Point nonsense_variant . exon 1 133422526 0.00001115
3 c.84G>A p.Trp28Ter rs2130769073 Point nonsense_variant Likely pathogenic exon 1 133422527 6.20E-07
4 c.130C>T p.Gln44Ter rs1554784015 Point nonsense_variant Pathogenic/Likely pathogenic exon 2 133423125 6.20E-07
5 c.237C>G p.Ile79Met rs281875297 Point missense_variant not provided exon 3 133424385 6.20E-07
6 c.262G>A p.Val88Met rs281875302 Point missense_variant conflicting exon 3 133424410 0.00000557
7 c.262G>C p.Val88Leu . Point missense_variant . exon 3 133424410 6.20E-07
8 c.283G>C p.Ala95Pro . Point missense_variant . exon 3 133424431 .
9 c.286C>G p.His96Asp rs121908467 Point missense_variant Pathogenic exon 3 133424434 0.00000123
10 c.287_288del p.His96Profs*42 . Deletion Deletion . exon 3 133424435 .
11 c.291G>T p.Gln97His . Point missense_variant . exon 3 133424438 .
12 c.291_319del p.Glu98ProfsTer31 rs387906345 Deletion frameshift_variant Pathogenic exon 3 133424430 0.00000123
13 c.304C>A p.Arg102Ser rs121908469 Point missense_variant . exon 3 133424452 1.24E-06
14 c.304C>T p. Arg102Cys rs121908469 Point missense_variant Pathogenic exon 3 133424452 1.18E-05
15 c.334delG p.Ala111GlnfsTer18 . Deletion Deletion . exon 4 133425527 6.20E-07
16 c.356C>T p.Ser119Phe . Point missense_variant . exon 4 133425554 .
17 c.372_373insGT p.Arg125Valfs*6 . Insertion Insertion . exon 4 133425570 .
18 c.427A>T p.Ile143Phe . Point missense_variant . exon 5 133425950 .
19 c.428T>C p.Ile143Thr . Point missense_variant . exon 5 133425951 .
20 c.436A>T p.Asn146Tyr rs888709549 Point missense_variant Uncertain signiificance exon 5 133425959 0.00000247
21 c.460G>A p.Val154Ile rs369026148 Point missense_variant Uncertain signiificance exon 5 133425983 0.00001487
22 c.496G>A p.Asp166Asn rs781825239 Point missense_variant . exon 5 133426019 0.00001797
23 c.518A>G p.Asp173Gly rs1554785165 Point missense_variant . exon 5 133426041 0.00000185
24 c.530A>G p.Tyr177Cys rs200594025 Point missense_variant . exon 5 133426053 6.20E-07
25 c.533T>C p.Ile178Thr . Point missense_variant . exon 5 133426056 .
26 c.568C>T p.Arg190Trp rs782650307 Point missense_variant Uncertain signiificance exon 6 133426227 0.00001054
27 c.605G>A p.Cys202Tyr . Point missense_variant . exon 6 133426264 6.20E-07
28 c.607T>C p.Ser203Pro . Point missense_variant . exon 6 133426266 .
29 c.623G>C p.Cys208Ser rs782442144 Point missense_variant . exon 6 133426282 6.21E-07
30 c.665T>C p.Ile222Thr . Point missense_variant . exon 6 133426324 .
31 c.681G>C p.Gly227Arg . Point missense_variant . exon 7 133426338 0.00000124
32 c.702C>A p.His234Gln . Point missense_variant Likely pathogenic exon 7 133428649 .
33 c.703G>C p.Asp235His . Point missense_variant . exon 7 133428650 .
34 c.708_709insG Ala237GlyfsTer153 . Insertion frameshift_variant . exon 7 133428655 .
35 c.708delC p.Ala237Argfs*12 . Deletion Deletion . exon 7 133428655 .
36 c.721delG p.Gly241fs . Deletion Deletion exon 7 133428668 .
37 c.725G>A p.Cys242Tyr . Point missense_variant Conflicting classifications of pathogenicity exon 7 133428672 7.35E-07
38 c.768_774del7 p.Arg257Alafs*13 . Deletion Deletion . exon 7 133428712 .
39 c.788C>G p.Ser263Cys . Point missense_variant . exon 7 133428734 .
40 c.794G>C p.Cys265Ser . Point missense_variant Uncertain signiificance exon 7 133428741 0.00000294
41 c.794G>A p.Cys265Tyr . Point missense_variant . exon 7 133428741 7.37E-07
42 c.796A>T p.Ser266Cys . Point missense_variant . exon 7 133428743 0.00000295
43 c.841T>A p.Cys281Ser . Point missense_variant exon 8 .
44 c.844G>C p.Val282Leu rs782674608 Point missense_variant . exon 8 133429958 0.0000039
45 c.914A>G p.Tyr305Cys . Point missense_variant exon 8 .
46 c.932G>A p.Cys311Tyr . Point missense_variant exon 8 .
47 c.972C>A p.Phe324Leu rs782268976 Point missense_variant . exon 8 133430086 0.00000314
48 c.1007_1025dup19 p.Asp343LeufsTer53 . Insertion Insertion . exon 9 133432607 .
49 c.1058C>T p.Pro353Leu rs281875338 Point missense_variant Likely pathogenic exon 9 133432658 2.82E-05
50 c.1093T>G p.Trp365Gly . Point missense_variant . exon 10 133433378 .
51 c.1097G>A p.Cys366Tyr . Point missense_variant . exon 10 133433382 .
52 c.1073G>A p.Gly385Glu . Point missense_variant . exon 10 133433439 .
53 c.1160G>C p.Trp387Ser rs780251348 Point missense_variant . exon 10 133433445 6.20E-07
54 c.1198T>C p.Cys400Arg . Point missense_variant . exon 10 133433483 .
55 c.1226G>A p.Arg409Gln rs1588165946 Point missense_variant Uncertain signiificance exon 10 133433511 0.00000309
56 c.1256G>T p.Gly419Val rs1024726284 Point missense_variant . exon 11 133433652 6.20E-07
57 c.1261C>T p.Arg421Cys rs145825553 Point missense_variant Conflicting classifications of pathogenicity exon 11 133433657 0.0005521
58 c.1285C>T p.Gln429Ter . Point nonsense_variant . exon 11 133433682 .
59 c.1297T>C p.Cys433Arg . Point missense_variant . exon 11 133433693 .
60 c.1297T>G p.Cys433Gly . Point missense_variant . exon 11 133433693 .
61 c.1305delT p.Thr435Serfs* . Deletion Deletion . exon 11 133433701 .
62 c.1312T>C p.Cys438Arg . Point missense_variant . exon 12 133436832 .
63 c.1313G>C p.Cys438Ser . Point missense_variant . exon 12 133436833 .
64 c.1328T>C p.Leu443Pro . Point missense_variant . exon 12 133436848 .
65 c.1335delC p.Phe445LeufsTer52 . Deletion frameshift_variant . exon 12 133436855 6.39E-07
66 c.1368G>C p.Gln456His . Point missense_variant . exon 12 133436888 .
67 c.1368G>T p.Gln456His rs36220239 Point missense_variant Benign/Likely Benign exon 12 133436888 0.002818
68 c.1382C>A p.Ser461Tyr . Point missense_variant . exon 12 133436903 .
69 c.1408dup p.Trp470Leufs*64 . Duplication frameshift_variant . exon 12 133436928 .
70 c.1409G>A p.Trp470Ter rs1554789233 Point nonsense_variant . exon 12 133436928 6.28E-07
71 c.1423C>T p.Pro475Ser rs11575933 Point missense_variant Conflicting classifications of pathogenicity exon 12 133436943 0.002441
72 c.1435_1436insG p.Asp480GlyfsTer54 . Insertion frameshift_variant . exon 13 133437748 .
73 c.1491G>C p.Lys497Asn rs781786860 Point missense_variant Uncertain signiificance exon 13 133437804 0.00000991
74 c.1510G>T p.Asp504Tyr . Point missense_variant . exon 13 133437823 .
75 c.1520G>A p.Arg507Gln rs281875296 Point missense_variant Not provided exon 13 133437833 6.82E-06
76 c.1564T>C p.Cys522Arg . Point missense_variant . exon 13 133437877 .
77 c.1574G>A p.Gly525Asp . Point missense_variant . exon 13 133437887 6.20E-07
78 c.1595G>T p.Cys532Phe . Point missense_variant . exon 14 133438256 .
79 c.1624T>G p.Trp542Gly . Point missense_variant . exon 14 133438285 6.20E-07
80 c.1643G>T p.Cys548Phe . Point missense_variant . exon 14 133438304 .
81 c.1648G>A p.Gly550Arg . Point missense_variant . exon 14 133438309 .
82 c.1651G>T p.Asp551Tyr . Point missense_variant . exon 14 133438312 .
83 c.1703G>T p.Arg568Ile rs1554789735 Point missense_variant . exon 14 133438364 0.00000185
84 c.1778C>T p.Thr593Ile . Point missense_variant . exon 15 133439438 6.20E-07
85 c.1851C>G p.Tyr617Ter rs371266006 Point nonsense_variant . exon 16 133440408 0.00000185
86 c.1867G>A p.Asp623Asn rs1841581998 Point missense_variant . exon 16 133440424 0.00000247
87 c.1883A>G p.Tyr628Cys . Point missense_variant . exon 16 133440440 0.00000123
88 c.1892C>T p.Ala631Val . Point missense_variant . exon 16 133440449 .
89 c.1928T>G p.Ile643Ser . Point missense_variant . exon 16 133440484 .
90 c.2012C>A p.Pro671Gln . Point missense_variant . exon 17 133442442 .
91 c.2050C>T p.Gln684Ter rs370121816 Point nonsense_variant Pathogenic exon 17 133442480 0.00000185
92 c.2058G>A p.Trp686Ter . Point nonsense_variant . exon 17 133442488 .
93 c.2063delG p.Trp688Ter rs1554791108 Deletion nonsense_variant . exon 17 133442493 6.20E-07
94 c.2074C>T p.Arg692Cys rs121908475 Point missense_variant Pathogenic exon 17 133442504 6.82E-06
95 c.2104G>A p.Gly702Arg . Point missense_variant . exon 18 133442613 .
96 c.2105G>T p.Gly702Val . Point missense_variant . exon 18 133442614 .
97 c.2107T>C p.Leu703Pro . Point missense_variant . exon 18 133442617 0.00000124
98 c.2130C>G p.Cys710Trp . Point missense_variant . exon 18 133442639 .
99 c.2137delC p.Gln713ArgfsTer65 . Deletion frameshift_variant . exon 18 133442646 6.20E-07
100 c.2188C>T p.Pro730Ser . Point missense_variant . exon 18 133442697 .
101 c.2203G>T p.Glu735Ter . Point nonsense_variant . exon 18 133442712 .
102 c.2272T>C p.Cys758Arg rs281875300 Point missense_variant Likely pathogenic exon 19 133443413 1.25E-06
103 c.2275G>A p.Gly759Arg rs782640568 Point missense_variant . exon 19 133443416 6.25E-07
104 c.2351G>A p.Arg784Gln rs377187626 Point missense_variant Uncertain signiificance exon 19 133443492 0.00002961
105 c.2357G>A p.Arg786Lys . Point missense_variant . exon 19 133443498 .
106 c.2397C>A p.Cys799Ter . Point nonsense_variant . exon 19 133443538 .
107 c.2404C>T p.Gln802Ter . Point nonsense_variant . exon 19 133443545 .
108 c.2434G>T p.Glu812Ter . Point missense_variant . exon 20 133444876 .
109 c.2548G>A p.Asp850Asn rs782584684 Point missense_variant . exon 20 133444990 6.20E-07
110 c.2651G>A p.Trp884Ter rs781844998 Point nonsense_variant . exon 21 133445739 6.20E-07
111 c.2677G>C p.Ala893Pro rs1311406038 Point missense_variant . exon 21 133445765 0.00000342
112 c.3070T>G p.Cys1024Gly rs121908472 Point missense_variant Pathogenic/Likely pathogenic exon 24 133454440 1.61E-05
113 c.2708C>T p.Ser903Leu rs78977446 Point missense_variant Benign/Likely Benign exon 21 133445796 0.00138
114 c.2723G>C p.Cys908Ser . Point missense_variant . exon 21 133445811 .
115 c.2724C>G p.Cys908Trp . Point missense_variant . exon 21 133445812 .
116 c.2725G>C p.Gly909Arg . Point missense_variant . exon 21 133445813 .
117 c.2746C>T p.Arg916Cys rs374444423 Point missense_variant Conflicting classifications of pathogenicity exon 22 133448613 3.17E-05
118 c.2785C>T p.Gln929Ter . Point nonsense_variant . exon 22 133448652 .
119 c.2839C>T p.Gln947Ter . Point nonsense_variant . exon 22 133448706 .
120 c.2865G>A p.Trp955X . Point nonsense_variant . exon 23 133449786 .
121 c.2867A>C p.Gln956Pro . Point missense_variant . exon 23 133449788 .
122 c.2883del p.Cys962Alafs*3 . Deletion Deletion . exon 23 133449804 .
123 c.2890G>A p.Val964Met rs141811556 Point missense_variant Conflicting classifications of pathogenicity exon 23 133449811 0.00009294
124 c.2930_2935delGTGCCC . . Deletion Deletion . exon 23 133449851 .
125 c.2930G>T p.Cys977Phe . Point missense_variant . exon 23 133449851 .
126 c.3014A>T p.Glu1005Val . Point missense_variant . exon 23 133449935 .
127 c.3033delC p.Cys1012AlafsX109 . Deletion Deletion . exon 23 133449954 .
128 c.3047G>A p.Trp1016Ter . Point nonsense_variant . exon 24 133454417 .
129 c.3092G>A p.Gly1031Asp . Point missense_variant . exon 24 133454462 .
130 c.3100A>T p.Arg1034Ter . Point nonsense_variant . exon 24 133454470 .
131 c.3107C>A p.Ser1036Ter . Point missense_variant . exon 24 133454477 .
132 c.3116G>A p.Cys1039Tyr . Point missense_variant . exon 24 133454486 .
133 c.3178C>T p.Arg1060Trp rs142572218 Point missense_variant Pathogenic/Likely pathogenic exon 24 133454548 0.001095
134 c.3199T>A p.Cys1067Ser . Point missense_variant . exon 24 133454570 6.22E-07
135 c.3223C>T p.Arg1075Cys rs782700247 Point missense_variant Uncertain significance exon 24 133454593 0.00000436
136 c.3230A>C p.His1077Pro . Point missense_variant . exon 24 133454600 .
137 c.3242G>A p.Trp1081Ter . Point nonsense_variant . exon 24 133454612 .
138 c.3251G>A p.Cys1084Tyr . Point missense_variant . exon 25 133455286 .
139 c.3252_3253delCT p.Arg1096Ter . Deletion nonsense_variant exon 25 133455287 .
140 c.3367C>T p.Arg1123Cys rs281875340 Point missense_variant Pathogenic/Likely pathogenic exon 25 133455402 4.3411E-06
141 c.3368G>A p.Arg1123His rs782311861 Point missense_variant . exon 25 133455403 0.00000558
142 c.3390T>G p.Cys1130Trp . Point missense_variant . exon 25 133455425 .
143 c.3421delC p.His1141Thrfs*85 . Deletion Deletion . exon 25 133455456 .
144 c.3530G>A p.Arg1177Gln rs370692680 Point missense_variant Uncertain significance exon 25 133455565 0.00003048
145 c.3543del p.Gln1183ArgfsTer43 rs1060499780 Deletion frameshift_variant Likely pathogenic exon 25 133455575 0.00000124
146 c.3550G>T p.Asp1184Tyr . Point missense_variant . exon 27 133456545 .
147 c.3557T>C p.Leu1186Ser . Point missense_variant . exon 27 133456552 .
148 c.3567G>A p.Trp1189Ter . Point nonsense_variant Pathogenic exon 27 133456562 6.8435E-07
149 c.3628C>T p.Gln1210Ter . Point missense_variant exon 26 .
150 c.3657_3658insT p.Pro1220Serfs* . Insertion frameshift_variant exon 26 .
151 c.3667G>T p.Glu1223Ter . Point nonsense_variant exon 27 6.25E-07
152 c.3716G>T p.Gly1239Val . Point missense_variant exon 27 .
153 c.3728T>C p.Leu1243Pro . Point missense_variant exon 27 .
154 c.3772delA p.Asn1258ThrfsTer15 . Deletion Deletion exon 27 .
155 c.3854G>C p.Arg1285Pro . Point missense_variant exon 27 .
156 c.3923G>A p.Gly1308Asp . Point missense_variant exon 28 .
157 c.3988G>C p.Ala1330Pro . Point missense_variant . exon 29 133459052 .
158 c.4015del p.Ile1339SerfsTer21 . Deletion Deletion exon 28 .
159 c.4034del p.Asn1345ThrfsTer14 . Deletion frameshift_variant exon 29 0.00000656
160 c.4101dupG p.Thr1368Aspfs*20 . Duplication Duplication exon 29 .
161 c.4154A>C p.Gln1385Pro . Point missense_variant exon 29 .
162 c.4156G>C p.Ala1386Pro . Point missense_variant exon 29 .
163 c.4205G>C p.Arg1402Pro . Point missense_variant exon 29 .
164 c.1308+2_1308+5del . rs1554788243 Deletion Splicing Likely pathogenic intron 11 133433702 0.00000124
165 c.1584+5G>A . rs782235228 Point Splicing Conflicting classifications of pathogenicity intron 13 133437902 0.00001426
166 c.331-2_331-1delAG . rs1554784975 Deletion Splicing . intron 3 133425526 6.20E-07
167 c.415-1G>A . rs1554785114 Point Splicing Likely pathogenic intron 4 133425937 0.00000433
168 c.686+1G>A . . Point Splicing intron 6 6.25E-07
169 c.1016_1017delCA . . Deletion Deletion exon 9 .
170 c.106_107delAG p.Ser36fs*102 . Deletion Deletion exon 2 .
171 c.106-1G>C p.S36_C37delfs*102 . Splicing Splicing intron 1 .
172 c.1095_1112del p.Trp365_Arg370del . Deletion Deletion exon 10 .
173 c.1107_1126del p.Arg370fs . Deletion Deletion exon 10 .
174 c.1244+2T>G . . Point Splicing intron 10 .
175 c.1245-3C>T . rs36219902 Point Splicing Conflicting classifications of pathogenicity intron 10 133433638 0.001695
176 c.1309-1G>A . . Point Splicing intron 11 6.42E-07
177 c.1309-25C>A . . Splicing Splicing intron 11 .
178 c.1435+1dupG . rs782472621 Splicing Splicing . exon 12 133436954 0.00000125
179 c.1435+2T>G . . Splicing Splicing intron 12 .
180 c.1436-2A>T . . Point Splicing intron 12 .
181 c.1460delG Cys487Serfs*10 . Deletion Deletion exon 13 .
182 c.1584+2T>A . . Splicing Splicing intron 13 .
183 c.1585-1G>C . . Splicing Splicing intron 13 .
184 c.1639_1640del p.Val547ValfsTer66 . Deletion Deletion exon 14 .
185 c.1649_1664del p.Gly550Alafs . Deletion Deletion exon 14 .
186 c.173-14_173-2del12 . . Deletion Deletion intron 2 .
187 c.1783_1784delTT p.His594Leufs*18 . Deletion Deletion exon 15 .
188 c.1885delA p.Arg629Glufs*69 . Deletion Deletion exon 16 .
189 c.1908dupG p.Leu637Alafs*18 . Duplication Duplication exon 16 .
190 c.1999delA p.Asn667ThrfsTer31 . Deletion Deletion exon 17 .
191 c.2042delA p.Lys681Cysfs*16 . Deletion Deletion exon 17 .
192 c.2104+1G>A . . Splicing Splicing intron 17 .
193 c.2173delC Gln725Lysfs*53 . Deletion Deletion exon 18 .
194 c.2259delA p.Cys754Alafs*24 . Deletion Deletion exon 19 .
195 c.2321del p.Gly774AlafsTer4 . Deletion Deletion exon 19 .
196 c.2348_2420+10del83 p.Ala783GlyfsTer36 . Deletion Deletion exon 19 .
197 c.2362_2363delGG . . Deletion Deletion exon 19 .
198 c.2364-2365delGG p.Gly788Glyfs*56 . Deletion Deletion exon 19 .
199 c.2420+4_2420+19del . . Splicing Splicing intron 19 0.00000439
200 c.2434_2441delinsC p.Glu812Profs*29 . Deletion Deletion exon 20 .
201 c.2455delG p.Ala819Leufs*24 . Deletion Deletion exon 20 .
202 c.2549_2550delAT . . Deletion Deletion exon 20 .
203 c.2610+5G>C . . Splicing Splicing intron 20 .
204 c.2731+1G>A . . Point Splicing exon 21 .
205 c.2731+1G>T . . Point Splicing exon 21 .
206 c.2875_2876insT p.959Lfs29 . Insertion Insertion exon 23 .
207 c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA p.Gln97fsTer31 . Deletion Deletion exon 3 .
208 c.2917_2918del p.Arg973Asnfs*14 . Deletion Deletion exon 23 .
209 c.2939_2952del p.Ala980Glyfs*3 . Deletion Deletion exon 23 .
210 c.3015delA p.Ala1006Profs*115 . Deletion Deletion exon 23 .
211 c.3044+2430_3568+81del3291 . . Deletion Deletion exon 24, 25 .
212 c.3220_3223del p.Tyr1074Alafs*46 . Deletion Deletion exon 24 .
213 c.3254_3255delCT p.Ser1085Cysfs*12 . Deletion Deletion exon 25 .
214 c.330+1G>A . rs375415632 Point Splicing Pathogenic/Likely pathogenic intron 3 133424479 0.00000124
215 c.330+3G>C . . Splicing Splicing intron 3 .
216 c.331-2A>G . . Point Splicing intron 3 6.20E-07
217 c.333delG . . Deletion Deletion exon 4 .
218 c.3569-1G>A . . Splicing Splicing intron 25 .
219 c.3587delA p.His1196Profs*30 . Deletion Deletion exon 26 .
220 c.3639-3640delTG p.Ala1214Serfs*17 . Deletion Deletion exon 27 .
221 c.365del18 . . Deletion Deletion exon 10 .
222 c.3682delC Arg1228Alafs*33 . Deletion Deletion exon 26 .
223 c.3751_3892+587del729 . . Deletion Deletion exon 27 .
224 c.386delG p.Val129GlyfsTer6 . Deletion Deletion exon 4 .
225 c.3892+1G>A . rs1554796161 Point Splicing Likely pathogenic intron 27 133456720 0.00000128
226 c.4014delA . . Deletion Deletion exon 28 .
227 c.4049delC p.Glu1351ArgfsTer9 . Deletion Deletion exon 29 .
228 c.4091_4092insA p.His1364Glnfs*24 . Insertion Insertion exon 29 .
229 c.4119delG p.Gln1374Serfs*22 . Deletion Deletion exon 29 .
230 c.414+1G>A . rs786205077 Point Splicing Pathogenic intron 4 133425613 6.20E-07
231 c.415-10G>A p.Gly139Valfs*17 . Point Splicing exon 4 .
232 c.437del p.Asn146fs . Deletion Deletion exon 5 .
233 c.539+1G>A . . Splicing Splicing intron 5 .
234 c.687-2A>G . . Point Splicing intron 6 .
235 c.687-2delA . . Deletion Deletion intron 6 .
236 c.687-7C>A . . Splicing Splicing intron 6 0.00000152
237 c.688-8C>G . . Point Splicing exon 7 .
238 c.694dup p.Leu232ProfsTer158 . Duplication Duplication exon 7 .
239 c.717delC . . Deletion Deletion exon 7 .
240 c.718_724del . . Deletion Deletion exon 7 .
241 c.719_724del p.Gly241_Cys242del . Deletion Deletion exon 7 .
242 c.746_987+373del1782 . . Deletion Deletion exon 7 .
243 c.762_774del p.Pro256Serfs*12 . Deletion Deletion exon 7 .
244 c.794_803del p.Arg267CysfsTer2 . Deletion Deletion exon 7 .
245 c.82_83insT p.Cys27fs*138 . Insertion Insertion exon 1 .
246 c.987+5G>A . . Splicing Splicing intron 8 0.00000126
247 c.988-2A>C . rs1554787761 Point Splicing . intron 8 133432586 0.00000386
248 c.(686+1789_988-12)_(1308+159_1309-1725)dup . . Duplication frameshift_variant exon 9,10,11 .
249 c.305G>A p.Arg102His rs782716712 Point missense_variant Likely pathogenic exon 3 133424453 0.00009977
250 c.3070T>C p.Cys1024Arg . Point missense_variant exon 24 6.20E-07
251 c.3121C>T p.Gln1041Ter . Point nonsense_variant exon 24 6.20E-07
252 c.3198_3199del p.Cys1067SerfsTer30 rs782288601 Deletion frameshift_variant Pathogenic exon 24 133454567 0.00001057
253 c.3265G>T p.Gly1089Trp rs1842671370 Point missense_variant . exon 25 133455300 0.00000124
254 c.327C>G p.Asn109Lys rs1466092212 Point missense_variant . exon 3 0.00000433
255 c.3283C>T p.Arg1095Trp rs782383410 Point missense_variant Uncertain significance exon 25 0.00000435
256 c.3284G>A p.Arg1095Gln rs373569027 Point missense_variant Conflicting classifications of pathogenicity exon 25 0.00000311
257 c.3313C>T p.Gln1105Ter . Point nonsense_variant exon 25 6.21E-07
258 c.332G>A p.Gly111Glu . Point missense_variant exon 4 6.20E-07
259 c.3616C>T p.Arg1206Ter rs782818582 Point nonsense_variant Pathogenic exon 26 0.00000805
260 c.3637T>C p.Cys1213Arg rs1554795860 Point missense_variant Likely pathogenic exon 26 0.00000124
261 c.3638G>A p.Cys1213Tyr rs121908474 Point missense_variant Pathogenic exon 26 6.20E-07
262 c.3650T>C p.Ile1217Thr rs200847393 Point missense_variant Pathogenic exon 26 0.00001921
263 c.3655C>T p.Arg1219Trp rs281875339 Point missense_variant Not provided exon 26 0.00000433
264 c.3656G>A p.Arg1219Gln rs782649881 Point missense_variant Likely pathogenic exon 26 0.00002417
265 c.3779dupT p.Met1260IlefsTer34 rs1564445915 Duplication frameshift_variant . exon 27 133456605 0.00000186
266 c.3820C>T p.Arg1274Cys rs371964138 Point missense_variant Uncertain significance exon 27 133456647 0.000109
267 c.3825C>A p.Cys1275Ter rs782463983 Point nonsense_variant Likely pathogenic exon 27 133456652 6.23E-07
268 c.3904C>T p.Gln1302Ter rs2130956441 Point nonsense_variant . exon 28 133457921 6.20E-07
269 c.4006C>T p.Arg1336Trp rs281875308 Point missense_variant Not provided exon 28 133458023 0.00001054
270 c.4007G>A p.Arg1336Gln rs782213090 Point missense_variant Uncertain significance exon 28 133458024 0.00001736
271 c.4085A>T p.Asp1362Val . Point missense_variant exon 29 2.0538E-06
272 c.4135T>C p.Trp1379Arg rs1361529166 Point missense_variant . exon 29 133459031 0.0000031
273 c.4143dupA p.Glu1382ArgfsTer6 rs387906343 Duplication frameshift_variant Pathogenic exon 29 133459038 0.00005145
274 c.4184T>C p.Leu1395Pro . Point missense_variant exon 29 1.5935E-06
275 c.448T>C p.Ser150Pro rs1386875680 Point missense_variant . exon 5 133425971 0.00000185
276 c.470G>A p.Trp157Ter . Point nonsense_variant exon 5 6.20E-07
277 c.548T>A p.Leu183Gln rs1554785228 Point missense_variant . exon 6 133426207 0.00000309
278 c.559G>C p.Asp187His rs148312697 Point missense_variant Conflicting classifications of pathogenicity exon 6 133426218 0.0003966
279 c.577C>T p.Arg193Trp rs281875287 Point missense_variant Likely pathogenic exon 6 133426236 0.00001178
280 c.578G>A p.Arg193Gln rs782083669 Point missense_variant . exon 6 133426237 0.00001054
281 c.581G>T p.Gly194Val rs1554785242 Point missense_variant Uncertain significance exon 6 133426240 0.00000371
282 c.587C>T p.Thr196Ile rs121908470 Point missense_variant Pathogenic exon 6 133426246 0.00002666
283 c.649G>C p.Asp217His rs782305581 Point missense_variant Uncertain significance exon 6 133426308 0.0000218
284 c.655G>C p.Gly219Arg . Point missense_variant exon 6 6.23E-07
285 c.679G>A p.Gly227Arg . Point missense_variant exon 6 0.00000124
286 c.695T>A p.Leu232Gln rs281875292 Point missense_variant Not provided exon 7 133428642 7.85E-07
287 c.697G>A p.Glu233Lys rs1047417075 Point missense_variant . exon 7 133428644 0.00000222
288 c.701A>G p.His234Arg . Point missense_variant exon 7 7.68E-07
289 c.703G>T p.Asp235Tyr rs281875337 Point missense_variant Conflicting classifications of pathogenicity exon 7 133428650 0.00000228
290 c.706G>T p.Gly236Cys rs781916049 Point missense_variant . exon 7 133428653 0.00000225
291 c.724_729del p.Cys242_Gly243del . Deletion Deletion exon 7 0.00000297
292 c.749C>T p.Ala250Val rs121908478 Point missense_variant Pathogenic exon 7 133428696 7.33E-07
293 c.768_774dup p.Gly259ProfsTer133 . Duplication frameshift_variant exon 7 0.00000516
294 c.788C>T p.Ser263Phe . Point missense_variant exon 7 0.00000220
295 c.796A>T p.Ser266Cys . Point missense_variant exon 7 0.00000295
296 c.803G>C p.Arg268Pro rs121908477 Point missense_variant Pathogenic exon 7 133428750 7.39E-07
297 c.911A>G p.Tyr304Cys rs281875285 Point missense_variant Uncertain significance exon 8 133430025 0.00000251
298 c.915C>A p.Tyr305Ter rs1840627224 Point nonsense_variant . exon 8 133430029 0.00000815
299 c.934C>T p.Arg312Cys rs1554786790 Point missense_variant . exon 8 133430048 4.1567E-06
300 c.964T>G p.Cys322Gly rs931645668 Point missense_variant . exon 8 133430078 0.00000502
301 c.1039T>A p.Cys347Ser rs281875294 Point missense_variant Not provided exon 9 133432639 6.41E-07
302 c.1039T>C p.Cys347Arg . Point missense_variant exon 9 6.41E-07
303 c.1045C>T p.Arg349Cys rs281875288 Point missense_variant Pathogenic exon 9 133432645 0.00000320
304 c.1169G>A p.Trp390Ter rs374655146 Point nonsense_variant Pathogenic exon 10 133433454 3.7189E-06
305 c.1170G>C p.Trp390Cys rs281875306 Point missense_variant Not provided exon 10 133433455 6.20E-07
306 c.1177C>T p.Arg393Ter rs782570540 Point nonsense_variant Pathogenic exon 10 133433462 9.2967E-06
307 c.1187G>A p.Cys396Tyr . Point missense_variant exon 10 6.20E-07
308 c.1190C>T p.Ser397Phe rs1564418207 Point missense_variant . exon 10 133433475 6.8428E-07
309 c.1192C>T p.Arg398Cys rs376606652 Point missense_variant Likely pathogenic exon 10 133433477 0.00000371
310 c.1193G>A p.Arg398His rs121908471 Point missense_variant Likely pathogenic exon 10 133433478 0.00000657
311 c.1201G>A p.Gly401Arg rs782033728 Point missense_variant Uncertain significance exon 10 133433486 0.00000371
312 c.1225C>T p.Arg409Trp rs959872423 Point missense_variant Uncertain significance exon 10 133433510 0.00000433
313 c.1308G>C p.Gln436His rs587642546 Point missense_variant exon 11 0.00005938
314 c.1313G>T p.Cys438Phe rs1841265398 Point missense_variant exon 12 0.00000255
315 c.1345C>T p.Gln449Ter rs121908476 Point nonsense_variant exon 12 6.6203E-06
316 c.1370C>T p.Pro457Leu rs36220240 Point missense_variant exon 12 0.002119
317 c.1456_1457delAT p.Met486ValfsTer47 rs782242503 Deletion frameshift_variant exon 13 0.00000681
318 c.1492C>T p.Arg498Cys rs201457594 Point missense_variant exon 13 0.00001363
319 c.1523G>A p.Cys508Tyr rs281875305 Point missense_variant exon 13 0.00000185
320 c.1582A>G p.Arg528Gly rs121908473 Point missense_variant exon 13 6.20E-07
321 c.1786+1G>A p.Glu569Alafs*27 rs782077726 Point Splicing intron 15 6.20E-07
322 c.1709A>G p.Tyr570Cys . Point missense_variant exon 14 6.21E-07
323 c.1760A>C p.Asn587Thr . Point missense_variant exon 14 6.20E-07
324 c.1787C>T p.Ala596Val rs281875299 Point missense_variant exon 16 0.00000681
325 c.1816G>C p.Ala606Pro rs281875290 Point missense_variant exon 16 0.00000743
326 c.1921G>A p.Glu641Lys rs782547718 Point missense_variant exon 16 0.0000124
327 c.1922delA p.Glu641GlyfsTer57 . Deletion frameshift_variant exon 16 6.20E-07
328 c.1973A>G p.Tyr658Cys rs281875335 Point missense_variant exon 17 6.5694E-06
329 c.1976G>A p.Arg659Lys rs150764227 Point missense_variant exon 17 0.0002441
330 c.2000delA p.Asn667ThrfsTer31 . Deletion frameshift_variant exon 17 0.00000247
331 c.2012C>T p.Pro671Leu rs281875295 Point missense_variant exon 17 6.20E-07
332 c.2017A>T p.Ile673Phe rs281875307 Point missense_variant exon 17 0.00000681
333 c.2068G>A p.Ala690Thr rs374840594 Point missense_variant exon 17 0.00001611
334 c.2085C>G p.Cys695Trp rs2130875779 Point missense_variant exon 17 6.20E-07
335 c.2115G>A p.Trp705Ter rs782400086 Point nonsense_variant exon 18 6.20E-07
336 c.2167C>A p.Gln723Lys rs138014548 Point missense_variant exon 18 0.0001562
337 c.2260T>C p.Cys754Arg rs1554791473 Point missense_variant exon 19 0.00000187
338 c.2279delG p.Gly760Alafs*18 . Deletion frameshift_variant exon 19 0.00000125
339 c.2281G>A p.Gly761Ser rs782542048 Point missense_variant exon 19 0.00000250
340 c.2293C>T p.Arg765Trp rs782614158 Point missense_variant exon 19 0.00001379
341 c.2317C>T p.Gln773Ter rs1376759965 Point nonsense_variant exon 19 0.00000376
342 c.2376_2401del p.Ala793ProfsTer43 rs387906342 Deletion frameshift_variant exon 19 6.34E-07
343 c.2410T>C p.Cys804Arg rs754909071 Point missense_variant exon 19 0.00000128
344 c.2674C>T p.Gln892Ter rs1554792374 Point nonsense_variant exon 21 0.00000186
345 c.2723G>A p.Cys908Tyr rs281875301 Point missense_variant exon 21 0.00000126
346 c.2725G>A p.Gly909Arg rs138742754 Point missense_variant exon 21 0.00000696
347 c.2728C>T p.Arg910Ter rs781844824 Point nonsense_variant exon 21 0.00000823
348 c.2836T>C p.Cys946Arg . Point missense_variant exon 22 0.00000187
349 c.2851T>G p.Cys951Gly rs121908468 Point missense_variant exon 22 0.00000312
350 c.2914C>T p.Arg972Trp rs782315945 Point missense_variant exon 23 0.00001115
351 c.2929T>C p.Cys977Arg . Point missense_variant exon 23 0.00000123
352 c.1199del . . Deletion frameshift_variant exon 10 .
353 c.1584+442_1969-338delins2730_2731+660 . . Insertion insertion intron 13 .
354 c.1615del . . Deletion deletion exon 14 .
355 c.2032C>A p.Tyr677Ter . Point nonsense_variant exon 17 .
356 c.2119_2150dup . . Duplication Duplication exon 18 .
357 c.2882delC p.Cys962Alafs*3 . Deletion Deletion exon 23 .
358 c.3769insT Frameshift . Insertion Insertion exon 27 .
359 c.781del . . Deletion deletion exon 7 .
360 c.825-10_843del29 . . Deletion Deletion exon 8 .
361 c.3633C>G p.Asn1211Lys rs1842763401 Point missense_variant exon 26 .
362 c.3688T>A p.Tyr1230Asn rs782729077 Point missense_variant exon 26 6.30E-07
363 c.3829C>T p.Pro1277Ser . Point missense_variant exon 27 .
364 c.3338G>A p.Cys1113Tyr . Point missense_variant exon 25 .
365 c.1192C>G p.Arg398Gly . Point missense_variant exon 10 .
366 c.2167C>T p.Gln723Ter . Point nonsense_variant exon 18 133442676 .
367 g.133431780_133434514dup . . Duplication Duplication exon 9,10,11 133431780 .
368 c.946G>C p.Gly316Arg . Point missense_variant exon 8 133430060 .
369 c.1519C>T p.Arg507Trp rs909831139 Point missense_variant exon 13 133437832 0.00000433
370 c.3746G>T p.Gly1249Val . Point missense_variant exon 28 133457931 .
371 c.3633C>G p.Asn1211Lys rs1842763401 Point missense_variant exon 27 133456628 0.00000434
372 c.2411G>A p.Cys804Tyr rs2130881785 Point missense_variant Uncertain significance exon 19 133443552 0.00000193
373 c.1308+1G>T . Point Splicing intron
374 c.1403C>G p.Gln448Glu Point missense_variant exon 12
375 p.Trp28Leufs*111 Point
376 c.3735G>A p.Trp1245Ter Point missense_variant exon 27
377 p.Asp1240Tyr Point missense_variant
378 c.2218G>A p.Glu740Lys Point missense_variant
379 c.3287G>A p.Arg1096His Point missense_variant
380 p.Cys997Phe Point missense_variant exon 23
381 c.2939_2952del . Deletion Deletion
382 c.3801C>G p.Asn1267Lys Point missense_variant exon 27
383 c.3856T>A p.Tyr1286Asn Point missense_variant exon 27
384 c.3997C>T p.Pro1333Ser Point missense_variant exon 28
385 c.988-2A>G . Point Splicing . intron 8 133432586