Variants

Click a mut_id to open the detailed view of a specific variant. · Total shown: 385

Clear Advanced search

Variant list

mut_id mut_syn_HGVS aa_syn mut_type mut_eff exon_location e_i_numb coordinate_GRCh38 gnomAD_AF clinvar_classification rsid d_id
1 c.22dupG p.Ala8GlyfsTer131 Duplication frameshift_variant exon 1 133422462 0.00000433 Pathogenic/Likely pathogenic .
2 c.83G>A p.Trp28Ter Point nonsense_variant exon 1 133422526 0.00001115 . rs964642490
3 c.84G>A p.Trp28Ter Point nonsense_variant exon 1 133422527 6.20E-07 Likely pathogenic rs2130769073
4 c.130C>T p.Gln44Ter Point nonsense_variant exon 2 133423125 6.20E-07 Pathogenic/Likely pathogenic rs1554784015
5 c.237C>G p.Ile79Met Point missense_variant exon 3 133424385 6.20E-07 not provided rs281875297
6 c.262G>A p.Val88Met Point missense_variant exon 3 133424410 0.00000557 conflicting rs281875302
7 c.262G>C p.Val88Leu Point missense_variant exon 3 133424410 6.20E-07 . .
8 c.283G>C p.Ala95Pro Point missense_variant exon 3 133424431 . . .
9 c.286C>G p.His96Asp Point missense_variant exon 3 133424434 0.00000123 Pathogenic rs121908467
10 c.287_288del p.His96Profs*42 Deletion Deletion exon 3 133424435 . . .
11 c.291G>T p.Gln97His Point missense_variant exon 3 133424438 . . .
12 c.291_319del p.Glu98ProfsTer31 Deletion frameshift_variant exon 3 133424430 0.00000123 Pathogenic rs387906345
13 c.304C>A p.Arg102Ser Point missense_variant exon 3 133424452 1.24E-06 . rs121908469
14 c.304C>T p. Arg102Cys Point missense_variant exon 3 133424452 1.18E-05 Pathogenic rs121908469
15 c.334delG p.Ala111GlnfsTer18 Deletion Deletion exon 4 133425527 6.20E-07 . .
16 c.356C>T p.Ser119Phe Point missense_variant exon 4 133425554 . . .
17 c.372_373insGT p.Arg125Valfs*6 Insertion Insertion exon 4 133425570 . . .
18 c.427A>T p.Ile143Phe Point missense_variant exon 5 133425950 . . .
19 c.428T>C p.Ile143Thr Point missense_variant exon 5 133425951 . . .
20 c.436A>T p.Asn146Tyr Point missense_variant exon 5 133425959 0.00000247 Uncertain signiificance rs888709549
21 c.460G>A p.Val154Ile Point missense_variant exon 5 133425983 0.00001487 Uncertain signiificance rs369026148
22 c.496G>A p.Asp166Asn Point missense_variant exon 5 133426019 0.00001797 . rs781825239
23 c.518A>G p.Asp173Gly Point missense_variant exon 5 133426041 0.00000185 . rs1554785165
24 c.530A>G p.Tyr177Cys Point missense_variant exon 5 133426053 6.20E-07 . rs200594025
25 c.533T>C p.Ile178Thr Point missense_variant exon 5 133426056 . . .
26 c.568C>T p.Arg190Trp Point missense_variant exon 6 133426227 0.00001054 Uncertain signiificance rs782650307
27 c.605G>A p.Cys202Tyr Point missense_variant exon 6 133426264 6.20E-07 . .
28 c.607T>C p.Ser203Pro Point missense_variant exon 6 133426266 . . .
29 c.623G>C p.Cys208Ser Point missense_variant exon 6 133426282 6.21E-07 . rs782442144
30 c.665T>C p.Ile222Thr Point missense_variant exon 6 133426324 . . .
31 c.681G>C p.Gly227Arg Point missense_variant exon 7 133426338 0.00000124 . .
32 c.702C>A p.His234Gln Point missense_variant exon 7 133428649 . Likely pathogenic .
33 c.703G>C p.Asp235His Point missense_variant exon 7 133428650 . . .
34 c.708_709insG Ala237GlyfsTer153 Insertion frameshift_variant exon 7 133428655 . . .
35 c.708delC p.Ala237Argfs*12 Deletion Deletion exon 7 133428655 . . .
36 c.721delG p.Gly241fs Deletion Deletion exon 7 133428668 . .
37 c.725G>A p.Cys242Tyr Point missense_variant exon 7 133428672 7.35E-07 Conflicting classifications of pathogenicity .
38 c.768_774del7 p.Arg257Alafs*13 Deletion Deletion exon 7 133428712 . . .
39 c.788C>G p.Ser263Cys Point missense_variant exon 7 133428734 . . .
40 c.794G>C p.Cys265Ser Point missense_variant exon 7 133428741 0.00000294 Uncertain signiificance .
41 c.794G>A p.Cys265Tyr Point missense_variant exon 7 133428741 7.37E-07 . .
42 c.796A>T p.Ser266Cys Point missense_variant exon 7 133428743 0.00000295 . .
43 c.841T>A p.Cys281Ser Point missense_variant exon 8 . .
44 c.844G>C p.Val282Leu Point missense_variant exon 8 133429958 0.0000039 . rs782674608
45 c.914A>G p.Tyr305Cys Point missense_variant exon 8 . .
46 c.932G>A p.Cys311Tyr Point missense_variant exon 8 . .
47 c.972C>A p.Phe324Leu Point missense_variant exon 8 133430086 0.00000314 . rs782268976
48 c.1007_1025dup19 p.Asp343LeufsTer53 Insertion Insertion exon 9 133432607 . . .
49 c.1058C>T p.Pro353Leu Point missense_variant exon 9 133432658 2.82E-05 Likely pathogenic rs281875338
50 c.1093T>G p.Trp365Gly Point missense_variant exon 10 133433378 . . .
51 c.1097G>A p.Cys366Tyr Point missense_variant exon 10 133433382 . . .
52 c.1073G>A p.Gly385Glu Point missense_variant exon 10 133433439 . . .
53 c.1160G>C p.Trp387Ser Point missense_variant exon 10 133433445 6.20E-07 . rs780251348
54 c.1198T>C p.Cys400Arg Point missense_variant exon 10 133433483 . . .
55 c.1226G>A p.Arg409Gln Point missense_variant exon 10 133433511 0.00000309 Uncertain signiificance rs1588165946
56 c.1256G>T p.Gly419Val Point missense_variant exon 11 133433652 6.20E-07 . rs1024726284
57 c.1261C>T p.Arg421Cys Point missense_variant exon 11 133433657 0.0005521 Conflicting classifications of pathogenicity rs145825553
58 c.1285C>T p.Gln429Ter Point nonsense_variant exon 11 133433682 . . .
59 c.1297T>C p.Cys433Arg Point missense_variant exon 11 133433693 . . .
60 c.1297T>G p.Cys433Gly Point missense_variant exon 11 133433693 . . .
61 c.1305delT p.Thr435Serfs* Deletion Deletion exon 11 133433701 . . .
62 c.1312T>C p.Cys438Arg Point missense_variant exon 12 133436832 . . .
63 c.1313G>C p.Cys438Ser Point missense_variant exon 12 133436833 . . .
64 c.1328T>C p.Leu443Pro Point missense_variant exon 12 133436848 . . .
65 c.1335delC p.Phe445LeufsTer52 Deletion frameshift_variant exon 12 133436855 6.39E-07 . .
66 c.1368G>C p.Gln456His Point missense_variant exon 12 133436888 . . .
67 c.1368G>T p.Gln456His Point missense_variant exon 12 133436888 0.002818 Benign/Likely Benign rs36220239
68 c.1382C>A p.Ser461Tyr Point missense_variant exon 12 133436903 . . .
69 c.1408dup p.Trp470Leufs*64 Duplication frameshift_variant exon 12 133436928 . . .
70 c.1409G>A p.Trp470Ter Point nonsense_variant exon 12 133436928 6.28E-07 . rs1554789233
71 c.1423C>T p.Pro475Ser Point missense_variant exon 12 133436943 0.002441 Conflicting classifications of pathogenicity rs11575933
72 c.1435_1436insG p.Asp480GlyfsTer54 Insertion frameshift_variant exon 13 133437748 . . .
73 c.1491G>C p.Lys497Asn Point missense_variant exon 13 133437804 0.00000991 Uncertain signiificance rs781786860
74 c.1510G>T p.Asp504Tyr Point missense_variant exon 13 133437823 . . .
75 c.1520G>A p.Arg507Gln Point missense_variant exon 13 133437833 6.82E-06 Not provided rs281875296
76 c.1564T>C p.Cys522Arg Point missense_variant exon 13 133437877 . . .
77 c.1574G>A p.Gly525Asp Point missense_variant exon 13 133437887 6.20E-07 . .
78 c.1595G>T p.Cys532Phe Point missense_variant exon 14 133438256 . . .
79 c.1624T>G p.Trp542Gly Point missense_variant exon 14 133438285 6.20E-07 . .
80 c.1643G>T p.Cys548Phe Point missense_variant exon 14 133438304 . . .
81 c.1648G>A p.Gly550Arg Point missense_variant exon 14 133438309 . . .
82 c.1651G>T p.Asp551Tyr Point missense_variant exon 14 133438312 . . .
83 c.1703G>T p.Arg568Ile Point missense_variant exon 14 133438364 0.00000185 . rs1554789735
84 c.1778C>T p.Thr593Ile Point missense_variant exon 15 133439438 6.20E-07 . .
85 c.1851C>G p.Tyr617Ter Point nonsense_variant exon 16 133440408 0.00000185 . rs371266006
86 c.1867G>A p.Asp623Asn Point missense_variant exon 16 133440424 0.00000247 . rs1841581998
87 c.1883A>G p.Tyr628Cys Point missense_variant exon 16 133440440 0.00000123 . .
88 c.1892C>T p.Ala631Val Point missense_variant exon 16 133440449 . . .
89 c.1928T>G p.Ile643Ser Point missense_variant exon 16 133440484 . . .
90 c.2012C>A p.Pro671Gln Point missense_variant exon 17 133442442 . . .
91 c.2050C>T p.Gln684Ter Point nonsense_variant exon 17 133442480 0.00000185 Pathogenic rs370121816
92 c.2058G>A p.Trp686Ter Point nonsense_variant exon 17 133442488 . . .
93 c.2063delG p.Trp688Ter Deletion nonsense_variant exon 17 133442493 6.20E-07 . rs1554791108
94 c.2074C>T p.Arg692Cys Point missense_variant exon 17 133442504 6.82E-06 Pathogenic rs121908475
95 c.2104G>A p.Gly702Arg Point missense_variant exon 18 133442613 . . .
96 c.2105G>T p.Gly702Val Point missense_variant exon 18 133442614 . . .
97 c.2107T>C p.Leu703Pro Point missense_variant exon 18 133442617 0.00000124 . .
98 c.2130C>G p.Cys710Trp Point missense_variant exon 18 133442639 . . .
99 c.2137delC p.Gln713ArgfsTer65 Deletion frameshift_variant exon 18 133442646 6.20E-07 . .
100 c.2188C>T p.Pro730Ser Point missense_variant exon 18 133442697 . . .
101 c.2203G>T p.Glu735Ter Point nonsense_variant exon 18 133442712 . . .
102 c.2272T>C p.Cys758Arg Point missense_variant exon 19 133443413 1.25E-06 Likely pathogenic rs281875300
103 c.2275G>A p.Gly759Arg Point missense_variant exon 19 133443416 6.25E-07 . rs782640568
104 c.2351G>A p.Arg784Gln Point missense_variant exon 19 133443492 0.00002961 Uncertain signiificance rs377187626
105 c.2357G>A p.Arg786Lys Point missense_variant exon 19 133443498 . . .
106 c.2397C>A p.Cys799Ter Point nonsense_variant exon 19 133443538 . . .
107 c.2404C>T p.Gln802Ter Point nonsense_variant exon 19 133443545 . . .
108 c.2434G>T p.Glu812Ter Point missense_variant exon 20 133444876 . . .
109 c.2548G>A p.Asp850Asn Point missense_variant exon 20 133444990 6.20E-07 . rs782584684
110 c.2651G>A p.Trp884Ter Point nonsense_variant exon 21 133445739 6.20E-07 . rs781844998
111 c.2677G>C p.Ala893Pro Point missense_variant exon 21 133445765 0.00000342 . rs1311406038
112 c.3070T>G p.Cys1024Gly Point missense_variant exon 24 133454440 1.61E-05 Pathogenic/Likely pathogenic rs121908472
113 c.2708C>T p.Ser903Leu Point missense_variant exon 21 133445796 0.00138 Benign/Likely Benign rs78977446
114 c.2723G>C p.Cys908Ser Point missense_variant exon 21 133445811 . . .
115 c.2724C>G p.Cys908Trp Point missense_variant exon 21 133445812 . . .
116 c.2725G>C p.Gly909Arg Point missense_variant exon 21 133445813 . . .
117 c.2746C>T p.Arg916Cys Point missense_variant exon 22 133448613 3.17E-05 Conflicting classifications of pathogenicity rs374444423
118 c.2785C>T p.Gln929Ter Point nonsense_variant exon 22 133448652 . . .
119 c.2839C>T p.Gln947Ter Point nonsense_variant exon 22 133448706 . . .
120 c.2865G>A p.Trp955X Point nonsense_variant exon 23 133449786 . . .
121 c.2867A>C p.Gln956Pro Point missense_variant exon 23 133449788 . . .
122 c.2883del p.Cys962Alafs*3 Deletion Deletion exon 23 133449804 . . .
123 c.2890G>A p.Val964Met Point missense_variant exon 23 133449811 0.00009294 Conflicting classifications of pathogenicity rs141811556
124 c.2930_2935delGTGCCC . Deletion Deletion exon 23 133449851 . . .
125 c.2930G>T p.Cys977Phe Point missense_variant exon 23 133449851 . . .
126 c.3014A>T p.Glu1005Val Point missense_variant exon 23 133449935 . . .
127 c.3033delC p.Cys1012AlafsX109 Deletion Deletion exon 23 133449954 . . .
128 c.3047G>A p.Trp1016Ter Point nonsense_variant exon 24 133454417 . . .
129 c.3092G>A p.Gly1031Asp Point missense_variant exon 24 133454462 . . .
130 c.3100A>T p.Arg1034Ter Point nonsense_variant exon 24 133454470 . . .
131 c.3107C>A p.Ser1036Ter Point missense_variant exon 24 133454477 . . .
132 c.3116G>A p.Cys1039Tyr Point missense_variant exon 24 133454486 . . .
133 c.3178C>T p.Arg1060Trp Point missense_variant exon 24 133454548 0.001095 Pathogenic/Likely pathogenic rs142572218
134 c.3199T>A p.Cys1067Ser Point missense_variant exon 24 133454570 6.22E-07 . .
135 c.3223C>T p.Arg1075Cys Point missense_variant exon 24 133454593 0.00000436 Uncertain significance rs782700247
136 c.3230A>C p.His1077Pro Point missense_variant exon 24 133454600 . . .
137 c.3242G>A p.Trp1081Ter Point nonsense_variant exon 24 133454612 . . .
138 c.3251G>A p.Cys1084Tyr Point missense_variant exon 25 133455286 . . .
139 c.3252_3253delCT p.Arg1096Ter Deletion nonsense_variant exon 25 133455287 . .
140 c.3367C>T p.Arg1123Cys Point missense_variant exon 25 133455402 4.3411E-06 Pathogenic/Likely pathogenic rs281875340
141 c.3368G>A p.Arg1123His Point missense_variant exon 25 133455403 0.00000558 . rs782311861
142 c.3390T>G p.Cys1130Trp Point missense_variant exon 25 133455425 . . .
143 c.3421delC p.His1141Thrfs*85 Deletion Deletion exon 25 133455456 . . .
144 c.3530G>A p.Arg1177Gln Point missense_variant exon 25 133455565 0.00003048 Uncertain significance rs370692680
145 c.3543del p.Gln1183ArgfsTer43 Deletion frameshift_variant exon 25 133455575 0.00000124 Likely pathogenic rs1060499780
146 c.3550G>T p.Asp1184Tyr Point missense_variant exon 27 133456545 . . .
147 c.3557T>C p.Leu1186Ser Point missense_variant exon 27 133456552 . . .
148 c.3567G>A p.Trp1189Ter Point nonsense_variant exon 27 133456562 6.8435E-07 Pathogenic .
149 c.3628C>T p.Gln1210Ter Point missense_variant exon 26 . .
150 c.3657_3658insT p.Pro1220Serfs* Insertion frameshift_variant exon 26 . .
151 c.3667G>T p.Glu1223Ter Point nonsense_variant exon 27 6.25E-07 .
152 c.3716G>T p.Gly1239Val Point missense_variant exon 27 . .
153 c.3728T>C p.Leu1243Pro Point missense_variant exon 27 . .
154 c.3772delA p.Asn1258ThrfsTer15 Deletion Deletion exon 27 . .
155 c.3854G>C p.Arg1285Pro Point missense_variant exon 27 . .
156 c.3923G>A p.Gly1308Asp Point missense_variant exon 28 . .
157 c.3988G>C p.Ala1330Pro Point missense_variant exon 29 133459052 . . .
158 c.4015del p.Ile1339SerfsTer21 Deletion Deletion exon 28 . .
159 c.4034del p.Asn1345ThrfsTer14 Deletion frameshift_variant exon 29 0.00000656 .
160 c.4101dupG p.Thr1368Aspfs*20 Duplication Duplication exon 29 . .
161 c.4154A>C p.Gln1385Pro Point missense_variant exon 29 . .
162 c.4156G>C p.Ala1386Pro Point missense_variant exon 29 . .
163 c.4205G>C p.Arg1402Pro Point missense_variant exon 29 . .
164 c.1308+2_1308+5del . Deletion Splicing intron 11 133433702 0.00000124 Likely pathogenic rs1554788243
165 c.1584+5G>A . Point Splicing intron 13 133437902 0.00001426 Conflicting classifications of pathogenicity rs782235228
166 c.331-2_331-1delAG . Deletion Splicing intron 3 133425526 6.20E-07 . rs1554784975
167 c.415-1G>A . Point Splicing intron 4 133425937 0.00000433 Likely pathogenic rs1554785114
168 c.686+1G>A . Point Splicing intron 6 6.25E-07 .
169 c.1016_1017delCA . Deletion Deletion exon 9 . .
170 c.106_107delAG p.Ser36fs*102 Deletion Deletion exon 2 . .
171 c.106-1G>C p.S36_C37delfs*102 Splicing Splicing intron 1 . .
172 c.1095_1112del p.Trp365_Arg370del Deletion Deletion exon 10 . .
173 c.1107_1126del p.Arg370fs Deletion Deletion exon 10 . .
174 c.1244+2T>G . Point Splicing intron 10 . .
175 c.1245-3C>T . Point Splicing intron 10 133433638 0.001695 Conflicting classifications of pathogenicity rs36219902
176 c.1309-1G>A . Point Splicing intron 11 6.42E-07 .
177 c.1309-25C>A . Splicing Splicing intron 11 . .
178 c.1435+1dupG . Splicing Splicing exon 12 133436954 0.00000125 . rs782472621
179 c.1435+2T>G . Splicing Splicing intron 12 . .
180 c.1436-2A>T . Point Splicing intron 12 . .
181 c.1460delG Cys487Serfs*10 Deletion Deletion exon 13 . .
182 c.1584+2T>A . Splicing Splicing intron 13 . .
183 c.1585-1G>C . Splicing Splicing intron 13 . .
184 c.1639_1640del p.Val547ValfsTer66 Deletion Deletion exon 14 . .
185 c.1649_1664del p.Gly550Alafs Deletion Deletion exon 14 . .
186 c.173-14_173-2del12 . Deletion Deletion intron 2 . .
187 c.1783_1784delTT p.His594Leufs*18 Deletion Deletion exon 15 . .
188 c.1885delA p.Arg629Glufs*69 Deletion Deletion exon 16 . .
189 c.1908dupG p.Leu637Alafs*18 Duplication Duplication exon 16 . .
190 c.1999delA p.Asn667ThrfsTer31 Deletion Deletion exon 17 . .
191 c.2042delA p.Lys681Cysfs*16 Deletion Deletion exon 17 . .
192 c.2104+1G>A . Splicing Splicing intron 17 . .
193 c.2173delC Gln725Lysfs*53 Deletion Deletion exon 18 . .
194 c.2259delA p.Cys754Alafs*24 Deletion Deletion exon 19 . .
195 c.2321del p.Gly774AlafsTer4 Deletion Deletion exon 19 . .
196 c.2348_2420+10del83 p.Ala783GlyfsTer36 Deletion Deletion exon 19 . .
197 c.2362_2363delGG . Deletion Deletion exon 19 . .
198 c.2364-2365delGG p.Gly788Glyfs*56 Deletion Deletion exon 19 . .
199 c.2420+4_2420+19del . Splicing Splicing intron 19 0.00000439 .
200 c.2434_2441delinsC p.Glu812Profs*29 Deletion Deletion exon 20 . .
201 c.2455delG p.Ala819Leufs*24 Deletion Deletion exon 20 . .
202 c.2549_2550delAT . Deletion Deletion exon 20 . .
203 c.2610+5G>C . Splicing Splicing intron 20 . .
204 c.2731+1G>A . Point Splicing exon 21 . .
205 c.2731+1G>T . Point Splicing exon 21 . .
206 c.2875_2876insT p.959Lfs29 Insertion Insertion exon 23 . .
207 c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA p.Gln97fsTer31 Deletion Deletion exon 3 . .
208 c.2917_2918del p.Arg973Asnfs*14 Deletion Deletion exon 23 . .
209 c.2939_2952del p.Ala980Glyfs*3 Deletion Deletion exon 23 . .
210 c.3015delA p.Ala1006Profs*115 Deletion Deletion exon 23 . .
211 c.3044+2430_3568+81del3291 . Deletion Deletion exon 24, 25 . .
212 c.3220_3223del p.Tyr1074Alafs*46 Deletion Deletion exon 24 . .
213 c.3254_3255delCT p.Ser1085Cysfs*12 Deletion Deletion exon 25 . .
214 c.330+1G>A . Point Splicing intron 3 133424479 0.00000124 Pathogenic/Likely pathogenic rs375415632
215 c.330+3G>C . Splicing Splicing intron 3 . .
216 c.331-2A>G . Point Splicing intron 3 6.20E-07 .
217 c.333delG . Deletion Deletion exon 4 . .
218 c.3569-1G>A . Splicing Splicing intron 25 . .
219 c.3587delA p.His1196Profs*30 Deletion Deletion exon 26 . .
220 c.3639-3640delTG p.Ala1214Serfs*17 Deletion Deletion exon 27 . .
221 c.365del18 . Deletion Deletion exon 10 . .
222 c.3682delC Arg1228Alafs*33 Deletion Deletion exon 26 . .
223 c.3751_3892+587del729 . Deletion Deletion exon 27 . .
224 c.386delG p.Val129GlyfsTer6 Deletion Deletion exon 4 . .
225 c.3892+1G>A . Point Splicing intron 27 133456720 0.00000128 Likely pathogenic rs1554796161
226 c.4014delA . Deletion Deletion exon 28 . .
227 c.4049delC p.Glu1351ArgfsTer9 Deletion Deletion exon 29 . .
228 c.4091_4092insA p.His1364Glnfs*24 Insertion Insertion exon 29 . .
229 c.4119delG p.Gln1374Serfs*22 Deletion Deletion exon 29 . .
230 c.414+1G>A . Point Splicing intron 4 133425613 6.20E-07 Pathogenic rs786205077
231 c.415-10G>A p.Gly139Valfs*17 Point Splicing exon 4 . .
232 c.437del p.Asn146fs Deletion Deletion exon 5 . .
233 c.539+1G>A . Splicing Splicing intron 5 . .
234 c.687-2A>G . Point Splicing intron 6 . .
235 c.687-2delA . Deletion Deletion intron 6 . .
236 c.687-7C>A . Splicing Splicing intron 6 0.00000152 .
237 c.688-8C>G . Point Splicing exon 7 . .
238 c.694dup p.Leu232ProfsTer158 Duplication Duplication exon 7 . .
239 c.717delC . Deletion Deletion exon 7 . .
240 c.718_724del . Deletion Deletion exon 7 . .
241 c.719_724del p.Gly241_Cys242del Deletion Deletion exon 7 . .
242 c.746_987+373del1782 . Deletion Deletion exon 7 . .
243 c.762_774del p.Pro256Serfs*12 Deletion Deletion exon 7 . .
244 c.794_803del p.Arg267CysfsTer2 Deletion Deletion exon 7 . .
245 c.82_83insT p.Cys27fs*138 Insertion Insertion exon 1 . .
246 c.987+5G>A . Splicing Splicing intron 8 0.00000126 .
247 c.988-2A>C . Point Splicing intron 8 133432586 0.00000386 . rs1554787761
248 c.(686+1789_988-12)_(1308+159_1309-1725)dup . Duplication frameshift_variant exon 9,10,11 . .
249 c.305G>A p.Arg102His Point missense_variant exon 3 133424453 0.00009977 Likely pathogenic rs782716712
250 c.3070T>C p.Cys1024Arg Point missense_variant exon 24 6.20E-07 .
251 c.3121C>T p.Gln1041Ter Point nonsense_variant exon 24 6.20E-07 .
252 c.3198_3199del p.Cys1067SerfsTer30 Deletion frameshift_variant exon 24 133454567 0.00001057 Pathogenic rs782288601
253 c.3265G>T p.Gly1089Trp Point missense_variant exon 25 133455300 0.00000124 . rs1842671370
254 c.327C>G p.Asn109Lys Point missense_variant exon 3 0.00000433 . rs1466092212
255 c.3283C>T p.Arg1095Trp Point missense_variant exon 25 0.00000435 Uncertain significance rs782383410
256 c.3284G>A p.Arg1095Gln Point missense_variant exon 25 0.00000311 Conflicting classifications of pathogenicity rs373569027
257 c.3313C>T p.Gln1105Ter Point nonsense_variant exon 25 6.21E-07 .
258 c.332G>A p.Gly111Glu Point missense_variant exon 4 6.20E-07 .
259 c.3616C>T p.Arg1206Ter Point nonsense_variant exon 26 0.00000805 Pathogenic rs782818582
260 c.3637T>C p.Cys1213Arg Point missense_variant exon 26 0.00000124 Likely pathogenic rs1554795860
261 c.3638G>A p.Cys1213Tyr Point missense_variant exon 26 6.20E-07 Pathogenic rs121908474
262 c.3650T>C p.Ile1217Thr Point missense_variant exon 26 0.00001921 Pathogenic rs200847393
263 c.3655C>T p.Arg1219Trp Point missense_variant exon 26 0.00000433 Not provided rs281875339
264 c.3656G>A p.Arg1219Gln Point missense_variant exon 26 0.00002417 Likely pathogenic rs782649881
265 c.3779dupT p.Met1260IlefsTer34 Duplication frameshift_variant exon 27 133456605 0.00000186 . rs1564445915
266 c.3820C>T p.Arg1274Cys Point missense_variant exon 27 133456647 0.000109 Uncertain significance rs371964138
267 c.3825C>A p.Cys1275Ter Point nonsense_variant exon 27 133456652 6.23E-07 Likely pathogenic rs782463983
268 c.3904C>T p.Gln1302Ter Point nonsense_variant exon 28 133457921 6.20E-07 . rs2130956441
269 c.4006C>T p.Arg1336Trp Point missense_variant exon 28 133458023 0.00001054 Not provided rs281875308
270 c.4007G>A p.Arg1336Gln Point missense_variant exon 28 133458024 0.00001736 Uncertain significance rs782213090
271 c.4085A>T p.Asp1362Val Point missense_variant exon 29 2.0538E-06 .
272 c.4135T>C p.Trp1379Arg Point missense_variant exon 29 133459031 0.0000031 . rs1361529166
273 c.4143dupA p.Glu1382ArgfsTer6 Duplication frameshift_variant exon 29 133459038 0.00005145 Pathogenic rs387906343
274 c.4184T>C p.Leu1395Pro Point missense_variant exon 29 1.5935E-06 .
275 c.448T>C p.Ser150Pro Point missense_variant exon 5 133425971 0.00000185 . rs1386875680
276 c.470G>A p.Trp157Ter Point nonsense_variant exon 5 6.20E-07 .
277 c.548T>A p.Leu183Gln Point missense_variant exon 6 133426207 0.00000309 . rs1554785228
278 c.559G>C p.Asp187His Point missense_variant exon 6 133426218 0.0003966 Conflicting classifications of pathogenicity rs148312697
279 c.577C>T p.Arg193Trp Point missense_variant exon 6 133426236 0.00001178 Likely pathogenic rs281875287
280 c.578G>A p.Arg193Gln Point missense_variant exon 6 133426237 0.00001054 . rs782083669
281 c.581G>T p.Gly194Val Point missense_variant exon 6 133426240 0.00000371 Uncertain significance rs1554785242
282 c.587C>T p.Thr196Ile Point missense_variant exon 6 133426246 0.00002666 Pathogenic rs121908470
283 c.649G>C p.Asp217His Point missense_variant exon 6 133426308 0.0000218 Uncertain significance rs782305581
284 c.655G>C p.Gly219Arg Point missense_variant exon 6 6.23E-07 .
285 c.679G>A p.Gly227Arg Point missense_variant exon 6 0.00000124 .
286 c.695T>A p.Leu232Gln Point missense_variant exon 7 133428642 7.85E-07 Not provided rs281875292
287 c.697G>A p.Glu233Lys Point missense_variant exon 7 133428644 0.00000222 . rs1047417075
288 c.701A>G p.His234Arg Point missense_variant exon 7 7.68E-07 .
289 c.703G>T p.Asp235Tyr Point missense_variant exon 7 133428650 0.00000228 Conflicting classifications of pathogenicity rs281875337
290 c.706G>T p.Gly236Cys Point missense_variant exon 7 133428653 0.00000225 . rs781916049
291 c.724_729del p.Cys242_Gly243del Deletion Deletion exon 7 0.00000297 .
292 c.749C>T p.Ala250Val Point missense_variant exon 7 133428696 7.33E-07 Pathogenic rs121908478
293 c.768_774dup p.Gly259ProfsTer133 Duplication frameshift_variant exon 7 0.00000516 .
294 c.788C>T p.Ser263Phe Point missense_variant exon 7 0.00000220 .
295 c.796A>T p.Ser266Cys Point missense_variant exon 7 0.00000295 .
296 c.803G>C p.Arg268Pro Point missense_variant exon 7 133428750 7.39E-07 Pathogenic rs121908477
297 c.911A>G p.Tyr304Cys Point missense_variant exon 8 133430025 0.00000251 Uncertain significance rs281875285
298 c.915C>A p.Tyr305Ter Point nonsense_variant exon 8 133430029 0.00000815 . rs1840627224
299 c.934C>T p.Arg312Cys Point missense_variant exon 8 133430048 4.1567E-06 . rs1554786790
300 c.964T>G p.Cys322Gly Point missense_variant exon 8 133430078 0.00000502 . rs931645668
301 c.1039T>A p.Cys347Ser Point missense_variant exon 9 133432639 6.41E-07 Not provided rs281875294
302 c.1039T>C p.Cys347Arg Point missense_variant exon 9 6.41E-07 .
303 c.1045C>T p.Arg349Cys Point missense_variant exon 9 133432645 0.00000320 Pathogenic rs281875288
304 c.1169G>A p.Trp390Ter Point nonsense_variant exon 10 133433454 3.7189E-06 Pathogenic rs374655146
305 c.1170G>C p.Trp390Cys Point missense_variant exon 10 133433455 6.20E-07 Not provided rs281875306
306 c.1177C>T p.Arg393Ter Point nonsense_variant exon 10 133433462 9.2967E-06 Pathogenic rs782570540
307 c.1187G>A p.Cys396Tyr Point missense_variant exon 10 6.20E-07 .
308 c.1190C>T p.Ser397Phe Point missense_variant exon 10 133433475 6.8428E-07 . rs1564418207
309 c.1192C>T p.Arg398Cys Point missense_variant exon 10 133433477 0.00000371 Likely pathogenic rs376606652
310 c.1193G>A p.Arg398His Point missense_variant exon 10 133433478 0.00000657 Likely pathogenic rs121908471
311 c.1201G>A p.Gly401Arg Point missense_variant exon 10 133433486 0.00000371 Uncertain significance rs782033728
312 c.1225C>T p.Arg409Trp Point missense_variant exon 10 133433510 0.00000433 Uncertain significance rs959872423
313 c.1308G>C p.Gln436His Point missense_variant exon 11 0.00005938 rs587642546
314 c.1313G>T p.Cys438Phe Point missense_variant exon 12 0.00000255 rs1841265398
315 c.1345C>T p.Gln449Ter Point nonsense_variant exon 12 6.6203E-06 rs121908476
316 c.1370C>T p.Pro457Leu Point missense_variant exon 12 0.002119 rs36220240
317 c.1456_1457delAT p.Met486ValfsTer47 Deletion frameshift_variant exon 13 0.00000681 rs782242503
318 c.1492C>T p.Arg498Cys Point missense_variant exon 13 0.00001363 rs201457594
319 c.1523G>A p.Cys508Tyr Point missense_variant exon 13 0.00000185 rs281875305
320 c.1582A>G p.Arg528Gly Point missense_variant exon 13 6.20E-07 rs121908473
321 c.1786+1G>A p.Glu569Alafs*27 Point Splicing intron 15 6.20E-07 rs782077726
322 c.1709A>G p.Tyr570Cys Point missense_variant exon 14 6.21E-07 .
323 c.1760A>C p.Asn587Thr Point missense_variant exon 14 6.20E-07 .
324 c.1787C>T p.Ala596Val Point missense_variant exon 16 0.00000681 rs281875299
325 c.1816G>C p.Ala606Pro Point missense_variant exon 16 0.00000743 rs281875290
326 c.1921G>A p.Glu641Lys Point missense_variant exon 16 0.0000124 rs782547718
327 c.1922delA p.Glu641GlyfsTer57 Deletion frameshift_variant exon 16 6.20E-07 .
328 c.1973A>G p.Tyr658Cys Point missense_variant exon 17 6.5694E-06 rs281875335
329 c.1976G>A p.Arg659Lys Point missense_variant exon 17 0.0002441 rs150764227
330 c.2000delA p.Asn667ThrfsTer31 Deletion frameshift_variant exon 17 0.00000247 .
331 c.2012C>T p.Pro671Leu Point missense_variant exon 17 6.20E-07 rs281875295
332 c.2017A>T p.Ile673Phe Point missense_variant exon 17 0.00000681 rs281875307
333 c.2068G>A p.Ala690Thr Point missense_variant exon 17 0.00001611 rs374840594
334 c.2085C>G p.Cys695Trp Point missense_variant exon 17 6.20E-07 rs2130875779
335 c.2115G>A p.Trp705Ter Point nonsense_variant exon 18 6.20E-07 rs782400086
336 c.2167C>A p.Gln723Lys Point missense_variant exon 18 0.0001562 rs138014548
337 c.2260T>C p.Cys754Arg Point missense_variant exon 19 0.00000187 rs1554791473
338 c.2279delG p.Gly760Alafs*18 Deletion frameshift_variant exon 19 0.00000125 .
339 c.2281G>A p.Gly761Ser Point missense_variant exon 19 0.00000250 rs782542048
340 c.2293C>T p.Arg765Trp Point missense_variant exon 19 0.00001379 rs782614158
341 c.2317C>T p.Gln773Ter Point nonsense_variant exon 19 0.00000376 rs1376759965
342 c.2376_2401del p.Ala793ProfsTer43 Deletion frameshift_variant exon 19 6.34E-07 rs387906342
343 c.2410T>C p.Cys804Arg Point missense_variant exon 19 0.00000128 rs754909071
344 c.2674C>T p.Gln892Ter Point nonsense_variant exon 21 0.00000186 rs1554792374
345 c.2723G>A p.Cys908Tyr Point missense_variant exon 21 0.00000126 rs281875301
346 c.2725G>A p.Gly909Arg Point missense_variant exon 21 0.00000696 rs138742754
347 c.2728C>T p.Arg910Ter Point nonsense_variant exon 21 0.00000823 rs781844824
348 c.2836T>C p.Cys946Arg Point missense_variant exon 22 0.00000187 .
349 c.2851T>G p.Cys951Gly Point missense_variant exon 22 0.00000312 rs121908468
350 c.2914C>T p.Arg972Trp Point missense_variant exon 23 0.00001115 rs782315945
351 c.2929T>C p.Cys977Arg Point missense_variant exon 23 0.00000123 .
352 c.1199del . Deletion frameshift_variant exon 10 . .
353 c.1584+442_1969-338delins2730_2731+660 . Insertion insertion intron 13 . .
354 c.1615del . Deletion deletion exon 14 . .
355 c.2032C>A p.Tyr677Ter Point nonsense_variant exon 17 . .
356 c.2119_2150dup . Duplication Duplication exon 18 . .
357 c.2882delC p.Cys962Alafs*3 Deletion Deletion exon 23 . .
358 c.3769insT Frameshift Insertion Insertion exon 27 . .
359 c.781del . Deletion deletion exon 7 . .
360 c.825-10_843del29 . Deletion Deletion exon 8 . .
361 c.3633C>G p.Asn1211Lys Point missense_variant exon 26 . rs1842763401
362 c.3688T>A p.Tyr1230Asn Point missense_variant exon 26 6.30E-07 rs782729077
363 c.3829C>T p.Pro1277Ser Point missense_variant exon 27 . .
364 c.3338G>A p.Cys1113Tyr Point missense_variant exon 25 . .
365 c.1192C>G p.Arg398Gly Point missense_variant exon 10 . .
366 c.2167C>T p.Gln723Ter Point nonsense_variant exon 18 133442676 . .
367 g.133431780_133434514dup . Duplication Duplication exon 9,10,11 133431780 . .
368 c.946G>C p.Gly316Arg Point missense_variant exon 8 133430060 . .
369 c.1519C>T p.Arg507Trp Point missense_variant exon 13 133437832 0.00000433 rs909831139
370 c.3746G>T p.Gly1249Val Point missense_variant exon 28 133457931 . .
371 c.3633C>G p.Asn1211Lys Point missense_variant exon 27 133456628 0.00000434 rs1842763401
372 c.2411G>A p.Cys804Tyr Point missense_variant exon 19 133443552 0.00000193 Uncertain significance rs2130881785
373 c.1308+1G>T . Point Splicing intron
374 c.1403C>G p.Gln448Glu Point missense_variant exon 12
375 p.Trp28Leufs*111 Point
376 c.3735G>A p.Trp1245Ter Point missense_variant exon 27
377 p.Asp1240Tyr Point missense_variant
378 c.2218G>A p.Glu740Lys Point missense_variant
379 c.3287G>A p.Arg1096His Point missense_variant
380 p.Cys997Phe Point missense_variant exon 23
381 c.2939_2952del . Deletion Deletion
382 c.3801C>G p.Asn1267Lys Point missense_variant exon 27
383 c.3856T>A p.Tyr1286Asn Point missense_variant exon 27
384 c.3997C>T p.Pro1333Ser Point missense_variant exon 28
385 c.988-2A>G . Point Splicing intron 8 133432586 .